Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7247594
End position: 7247617
Length: 24

DNA sequence
>NC_016935, from 7247594 to 7247617 (24 bp); Paenibacillus mucilaginosus 3016 GGCGCCGGGGCCGGCGTCGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7247186-7247974	Sequence	PM3016_6130 - hypothetical protein (Protein is coded in complementary strand; from 7247974 to 7247186)