Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 7221847
End position: 7221906
Length: 60

DNA sequence
>NC_016935, from 7221847 to 7221906 (60 bp); Paenibacillus mucilaginosus 3016 TCCGTCGTTGTTTCTGTTGTTGTTTCTGTCGTTGTTTCTGTTGTTGTTTCTGTCGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7221829-7222902	Sequence	PM3016_6108 - copper amine oxidase domain-containing protein (Protein is coded in complementary strand; from 7222902 to 7221829)