Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 6362686
End position: 6362709
Length: 24

DNA sequence
>NC_016935, from 6362686 to 6362709 (24 bp); Paenibacillus mucilaginosus 3016 AGCCGCTGCCGCCGCCGCACCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6361109-6362755	Sequence	PM3016_5329 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 6362755 to 6361109)