Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 6349425
End position: 6349454
Length: 30

DNA sequence
>NC_016935, from 6349425 to 6349454 (30 bp); Paenibacillus mucilaginosus 3016 ACGGGCCGCAACCGACCGCATCGGGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6349078-6349647	Sequence	PM3016_5320 - hypothetical protein (Protein is coded in complementary strand; from 6349647 to 6349078)