Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 6287251
End position: 6287313
Length: 63

DNA sequence
>NC_016935, from 6287251 to 6287313 (63 bp); Paenibacillus mucilaginosus 3016 AGCTCCTCATTGGTCGCCTGCAGCTCCTCGTTGGACGTCTCCAGCTCTTCAATGGTCGCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6285754-6289350	Sequence	PM3016_5259 - signal transduction histidine kinase with CheB and CheR activity (Protein is coded in complementary strand; from 6289350 to 6285754)