Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 6249454
End position: 6249477
Length: 24

DNA sequence
>NC_016935, from 6249454 to 6249477 (24 bp); Paenibacillus mucilaginosus 3016 CTGCACCTTCACCTGCTCGTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6249443-6250762	Sequence	PM3016_5228 - Exg1 protein (Protein is coded in complementary strand; from 6250762 to 6249443)