Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 6114191
End position: 6114214
Length: 24

DNA sequence
>NC_016935, from 6114191 to 6114214 (24 bp); Paenibacillus mucilaginosus 3016 CTCGTCCTCGTACTGGTCCCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6113982-6116585	Sequence	PM3016_5093 - stage III sporulation DNA translocase E (Protein is coded in complementary strand; from 6116585 to 6113982)