Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 6031996
End position: 6032040
Length: 45

DNA sequence
>NC_016935, from 6031996 to 6032040 (45 bp); Paenibacillus mucilaginosus 3016 TCCCCATGATCTTCCGCCTCATGATCTTCCGCTACATGATCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6031240-6032586	Sequence	PM3016_5014 - hypothetical protein (Protein is coded in complementary strand; from 6032586 to 6031240)