Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5975155
End position: 5975223
Length: 69

DNA sequence
>NC_016935, from 5975155 to 5975223 (69 bp); Paenibacillus mucilaginosus 3016 CATTAAACTTACTTCATCTTCATCATTAAACTTACTTCATCTTCATCATTAAACTTACTTCATATCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5975210-5976832	Sequence	PM3016_4967 - protein DppE (Protein is coded in complementary strand; from 5976832 to 5975210)