Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5877999
End position: 5878022
Length: 24

DNA sequence
>NC_016935, from 5877999 to 5878022 (24 bp); Paenibacillus mucilaginosus 3016 CCGTCACCGTCACCGTCACTGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5877318-5878412	Sequence	PM3016_4894 - S-layer protein (Protein is coded in complementary strand; from 5878412 to 5877318)