Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5752191
End position: 5752235
Length: 45

DNA sequence
>NC_016935, from 5752191 to 5752235 (45 bp); Paenibacillus mucilaginosus 3016 GTAGGTTTCTTTCTTGTAGGTTTCTTTCTTGTAGGTTTCTTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5749705-5752332	Sequence	PM3016_4778 - xyloglucanase (Protein is coded in complementary strand; from 5752332 to 5749705)