Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5622454
End position: 5622477
Length: 24

DNA sequence
>NC_016935, from 5622454 to 5622477 (24 bp); Paenibacillus mucilaginosus 3016 TCCGGCTCCGCCGCCGGCTGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5621417-5622502	Sequence	PM3016_4660 - cell surface glycoprotein 2 (Protein is coded in complementary strand; from 5622502 to 5621417)