Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5578306
End position: 5578353
Length: 48

DNA sequence
>NC_016935, from 5578306 to 5578353 (48 bp); Paenibacillus mucilaginosus 3016 CCAGAAATGAATTCAGAAATGAGTTCAGAAATGAGTTCAGAAATGAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5577324-5578364	Sequence	PM3016_4621 - cellulase Cel5K (Protein is coded in complementary strand; from 5578364 to 5577324)