Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5419016
End position: 5419051
Length: 36

DNA sequence
>NC_016935, from 5419016 to 5419051 (36 bp); Paenibacillus mucilaginosus 3016 GCGCTTCCGTCTGGGCTTCGGTCTTCACTTCCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5418712-5433540	Sequence	PM3016_4526 - fusaricidin synthetase (Protein is coded in complementary strand; from 5433540 to 5418712)