Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5312429
End position: 5312464
Length: 36

DNA sequence
>NC_016935, from 5312429 to 5312464 (36 bp); Paenibacillus mucilaginosus 3016 TTCATGGTTCTCTACCTGGTTCTCTACCTGGTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5310765-5312531	Sequence	PM3016_4465 - Gramicidin S synthetase 2 (Protein is coded in complementary strand; from 5312531 to 5310765)