Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5112656
End position: 5112718
Length: 63

DNA sequence
>NC_016935, from 5112656 to 5112718 (63 bp); Paenibacillus mucilaginosus 3016 ACATCGTTTCATCTCCCTTTCTCCTCATTTGATCTCCCTTTCTCCTCATTTGATCTCCCTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5111434-5112660	Sequence	PM3016_4289 - cytochrome P450 (Protein is coded in complementary strand; from 5112660 to 5111434)