Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 5031978
End position: 5032025
Length: 48

DNA sequence
>NC_016935, from 5031978 to 5032025 (48 bp); Paenibacillus mucilaginosus 3016 TTGTTTTATTTCTTGTTTTATTTCTTGTTTTATTTCTTGTTTTATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5032020-5033603	Sequence	PM3016_4232 - family 1 extracellular solute-binding protein (Protein is coded in complementary strand; from 5033603 to 5032020)