Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 4790814
End position: 4790849
Length: 36

DNA sequence
>NC_016935, from 4790814 to 4790849 (36 bp); Paenibacillus mucilaginosus 3016 TATCCATGCTTTCATGCATGCTTTCATCCATGCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4789766-4790845	Sequence	PM3016_4057 - ferrichrome ABC transporter permease (Protein is coded in complementary strand; from 4790845 to 4789766)
ORF... 4790838-4791860	Sequence	PM3016_4058 - transport system permease (Protein is coded in complementary strand; from 4791860 to 4790838)