Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 4781708
End position: 4781779
Length: 72

DNA sequence
>NC_016935, from 4781708 to 4781779 (72 bp); Paenibacillus mucilaginosus 3016 GTTTGGTCACCATACCTCTCTCCTGTTTGATCATAATACCTCTCTCCTTTTTAATCACAATACCTCTCTC CT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4779529-4781742	Sequence	PM3016_4049 - hypothetical protein (Protein is coded in complementary strand; from 4781742 to 4779529)