Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 4448050
End position: 4448103
Length: 54

DNA sequence
>NC_016935, from 4448050 to 4448103 (54 bp); Paenibacillus mucilaginosus 3016 GGTGCAGGTGTAGTTGTAGTTGTAGGTGTAGTTGTAGGTGTAGTTGTAGATGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4447339-4450248	Sequence	PM3016_3871 - chromosome condensation regulator RCC1 (Protein is coded in complementary strand; from 4450248 to 4447339)