Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 4245500
End position: 4245535
Length: 36

DNA sequence
>NC_016935, from 4245500 to 4245535 (36 bp); Paenibacillus mucilaginosus 3016 CTTCCGCCGCCTCTTCCGCCGCCTCTTCCGCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4233223-4248990	Sequence	PM3016_3707 - tyrocidine synthetase 3 (Protein is coded in complementary strand; from 4248990 to 4233223)