Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 2088506
End position: 2088529
Length: 24

DNA sequence
>NC_016935, from 2088506 to 2088529 (24 bp); Paenibacillus mucilaginosus 3016 AGAATCAGAATCAGAGTCAGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2087316-2089616	Sequence	PM3016_1854 - alpha amylase (Protein is coded in complementary strand; from 2089616 to 2087316)