Sequence retrieval

Genome: Paenibacillus mucilaginosus 3016
Start position: 1237214
End position: 1237258
Length: 45

DNA sequence
>NC_016935, from 1237214 to 1237258 (45 bp); Paenibacillus mucilaginosus 3016 GTGTTCTCCATCATCATGTTCTCTGTCATCGTGTTCTCAGTCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1236473-1237258	Sequence	PM3016_1083 - urea ABC transporter ATP-binding protein UrtE (Protein is coded in complementary strand; from 1237258 to 1236473)
ORF... 1237251-1238048	Sequence	PM3016_1084 - urea ABC transporter ATP-binding protein UrtD (Protein is coded in complementary strand; from 1238048 to 1237251)