Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 316
Start position: 607620
End position: 607661
Length: 42

DNA sequence
>NC_016932, from 607620 to 607661 (42 bp); Corynebacterium pseudotuberculosis 316 TGCTCTGGGTGTTGTGCTTGGGGTGTTGTGGTGTGGGTGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 607403-607801	Sequence	Cp316_0607 - hypothetical protein (Protein is coded in complementary strand; from 607801 to 607403)