Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 316
Start position: 2202842
End position: 2202871
Length: 30

DNA sequence
>NC_016932, from 2202842 to 2202871 (30 bp); Corynebacterium pseudotuberculosis 316 CCCACGCACAACCACACACACCCACACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
2201350-2204427	Sequence	Cp316_r11 23S ribosomal RNA (Protein is coded in complementary strand; from 2204427 to 2201350)