Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 316
Start position: 1825604
End position: 1825633
Length: 30

DNA sequence
>NC_016932, from 1825604 to 1825633 (30 bp); Corynebacterium pseudotuberculosis 316 CCCACGCACAACCACACACACCCACACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
1824110-1827188	Sequence	Cp316_r08 23S ribosomal RNA (Protein is coded in complementary strand; from 1827188 to 1824110)