Sequence retrieval

Genome: Corynebacterium pseudotuberculosis 316
Start position: 1121982
End position: 1122005
Length: 24

DNA sequence
>NC_016932, from 1121982 to 1122005 (24 bp); Corynebacterium pseudotuberculosis 316 GCAACGGCAAGGGCAATGCCAACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1121949-1123256	Sequence	Cp316_1088 dcuA Anaerobic C4-dicarboxylate transporter (Protein is coded in complementary strand; from 1123256 to 1121949)