Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3067075
End position: 3067137
Length: 63

DNA sequence
>NC_016906, from 3067075 to 3067137 (63 bp); Gordonia polyisoprenivorans VH2 GGGAGCGCTGTCGGCGTCGGGCTGGGCGCTGTCGGCGTCGGGCTGAGCGCTGTCGATGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3067043-3068887	Sequence	GPOL_c27030 lgt prolipoprotein diacylglyceryl transferase Lgt (Protein is coded in complementary strand; from 3068887 to 3067043)