Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4921661
End position: 4921720
Length: 60

DNA sequence
>NC_016906, from 4921661 to 4921720 (60 bp); Gordonia polyisoprenivorans VH2 TGGGGCGGATAGGACTCGGGCGGATACGACTGCGGTGGATATGACTGGGGCGGATACGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4921412-4923793	Sequence	GPOL_c43350 ftsH ATP-dependent zinc metalloprotease FtsH (Protein is coded in complementary strand; from 4923793 to 4921412)