Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4338801
End position: 4338860
Length: 60

DNA sequence
>NC_016906, from 4338801 to 4338860 (60 bp); Gordonia polyisoprenivorans VH2 GATTGGGCCGCCGTTGATTGGGCCGCCGTCGACTGGGCCGCCGTTGATTGGGCCGCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4335042-4341731	Sequence	GPOL_c38050 pfaA polyketide-type polyunsaturated fatty acid synthase PfaA (Protein is coded in complementary strand; from 4341731 to 4335042)