Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 390514
End position: 390573
Length: 60

DNA sequence
>NC_016906, from 390514 to 390573 (60 bp); Gordonia polyisoprenivorans VH2 GTGGCCTTCTTCGCCGCGGACTTCTTCGCCGCGGCTTTCTTTGCCGGTGCCTTCTTCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 390049-390825	Sequence	GPOL_c03240 - hypothetical protein (Protein is coded in complementary strand; from 390825 to 390049)