Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3269988
End position: 3270047
Length: 60

DNA sequence
>NC_016906, from 3269988 to 3270047 (60 bp); Gordonia polyisoprenivorans VH2 CGTCAGCCGGCAACCCACCGCGTCAGCCGGCAACCCACCGCGTCAGCCGGCAACCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3270031-3270915	Sequence	GPOL_c28790 - hypothetical protein (Protein is coded in complementary strand; from 3270915 to 3270031)