Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2656708
End position: 2656767
Length: 60

DNA sequence
>NC_016906, from 2656708 to 2656767 (60 bp); Gordonia polyisoprenivorans VH2 CCCGTGTCCCTGGCCCCCTTGTCCCTGGCCCCCTTGTCCTTGACCCCACTGCCCCTGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2656358-2657938	Sequence	GPOL_c23470 - hypothetical protein (Protein is coded in complementary strand; from 2657938 to 2656358)