Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2556716
End position: 2556775
Length: 60

DNA sequence
>NC_016906, from 2556716 to 2556775 (60 bp); Gordonia polyisoprenivorans VH2 GTGCCCACCGTCTTCCTGCCCACCGTCTTCCTGCCCACCGATTTCCTGCCCACCGTCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2556672-2557145	Sequence	GPOL_c22610 - hypothetical protein (Protein is coded in complementary strand; from 2557145 to 2556672)