Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2371935
End position: 2371994
Length: 60

DNA sequence
>NC_016906, from 2371935 to 2371994 (60 bp); Gordonia polyisoprenivorans VH2 CGATGACTTCCACGACGACGACCTCCACAACGACGACCTCCACAACGGTGACTTCTACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2371808-2374633	Sequence	GPOL_c20880 ftsK putative cell division protein FtsK