Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 2013486
End position: 2013545
Length: 60

DNA sequence
>NC_016906, from 2013486 to 2013545 (60 bp); Gordonia polyisoprenivorans VH2 CGTGGCTGGGCTGGGCTTGGCAGTGCTGGGCTTGGTCGGGCTGGGCTTGGTGGGGCTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2009884-2013783	Sequence	GPOL_c17750 sucA 2-oxoglutarate decarboxylase SucA (Protein is coded in complementary strand; from 2013783 to 2009884)