Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 18646
End position: 18705
Length: 60

DNA sequence
>NC_016906, from 18646 to 18705 (60 bp); Gordonia polyisoprenivorans VH2 CCTCGCGTTCGGTGCCCTCGCGTTCGGTGCCCTCGCGTTCGGTGCCCTCGCGTTCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 18540-19067	Sequence	GPOL_c00190 - hypothetical protein (Protein is coded in complementary strand; from 19067 to 18540)