Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 621508
End position: 621563
Length: 56

DNA sequence
>NC_016906, from 621508 to 621563 (56 bp); Gordonia polyisoprenivorans VH2 CGTCACCGTCACGTCATCACCCTCACGTCGTCACCGTCACGTCGTCACCGTCATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 620879-621520	Sequence	GPOL_c05240 - putative two-component system response regulator (Protein is coded in complementary strand; from 621520 to 620879)
ORF... 621545-622702	Sequence	GPOL_c05250 - signal transduction histidine kinase-like protein (Protein is coded in complementary strand; from 622702 to 621545)