Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3678765
End position: 3678818
Length: 54

DNA sequence
>NC_016906, from 3678765 to 3678818 (54 bp); Gordonia polyisoprenivorans VH2 GTCGTCCTGTTCATTGCGCTCGTCGTGTTCAGTGCGCTCGTCGTGTTCAGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3677539-3682212	Sequence	GPOL_c32740 - hypothetical protein (Protein is coded in complementary strand; from 3682212 to 3677539)