Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3522631
End position: 3522684
Length: 54

DNA sequence
>NC_016906, from 3522631 to 3522684 (54 bp); Gordonia polyisoprenivorans VH2 CTCGCTGCCAGAAGTCGTCTCGCTGCCAGAAGTCGTCTCGCTGCCAGAAGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3521822-3522688	Sequence	GPOL_c31100 - hypothetical protein (Protein is coded in complementary strand; from 3522688 to 3521822)