Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3451476
End position: 3451529
Length: 54

DNA sequence
>NC_016906, from 3451476 to 3451529 (54 bp); Gordonia polyisoprenivorans VH2 CTCGTGGCCTGTTCGAGCCTCGTGGCCTGTTCGAGCCTCGTGGCCTGTTCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3449205-3452870	Sequence	GPOL_c30460 afsR regulatory protein AfsR (Protein is coded in complementary strand; from 3452870 to 3449205)