Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 3128027
End position: 3128080
Length: 54

DNA sequence
>NC_016906, from 3128027 to 3128080 (54 bp); Gordonia polyisoprenivorans VH2 TGTTGGTCTCGGTGTTCTTGTTGGTCTCGGTGTTCTTGTTGGTCTCGGTGTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3127993-3128736	Sequence	GPOL_c27540 lspA lipoprotein signal peptidase LspA (Protein is coded in complementary strand; from 3128736 to 3127993)