Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 248222
End position: 248269
Length: 48

DNA sequence
>NC_016906, from 248222 to 248269 (48 bp); Gordonia polyisoprenivorans VH2 TACGGGCTGAACGGATCACGGGCTGAACGGATCACGGGCTGAACGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 248270-250000	Sequence	GPOL_c02060 - putative transmembrane protein (Protein is coded in complementary strand; from 250000 to 248270)