Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 1902384
End position: 1902431
Length: 48

DNA sequence
>NC_016906, from 1902384 to 1902431 (48 bp); Gordonia polyisoprenivorans VH2 GGGTCTCAGCCTTCGGGACGCTCAGCCTTCGGGACTCTCAACCTTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1902422-1902904	Sequence	GPOL_c16790 - hypothetical protein (Protein is coded in complementary strand; from 1902904 to 1902422)