Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 667092
End position: 667136
Length: 45

DNA sequence
>NC_016906, from 667092 to 667136 (45 bp); Gordonia polyisoprenivorans VH2 GGAACCTTCTGTGCCGGAACCTCGTGCGCCGGAACCTTCTGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 666174-669758	Sequence	GPOL_c05650 - putative integral membrane protein, MMPL family (Protein is coded in complementary strand; from 669758 to 666174)