Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 583650
End position: 583694
Length: 45

DNA sequence
>NC_016906, from 583650 to 583694 (45 bp); Gordonia polyisoprenivorans VH2 TCCTCCGAGCCGGGTTCGTCCCATCCGGGTTCGTCCCATCCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 583326-584921	Sequence	GPOL_c04930 - hypothetical protein (Protein is coded in complementary strand; from 584921 to 583326)