Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 5666558
End position: 5666602
Length: 45

DNA sequence
>NC_016906, from 5666558 to 5666602 (45 bp); Gordonia polyisoprenivorans VH2 CCGTCGTCCTCAGCACCGTCGTCCTCAGCACCGTCGTCCTCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5666096-5666671	Sequence	GPOL_c50260 - R3H domain-containing protein (Protein is coded in complementary strand; from 5666671 to 5666096)