Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 561761
End position: 561805
Length: 45

DNA sequence
>NC_016906, from 561761 to 561805 (45 bp); Gordonia polyisoprenivorans VH2 GGGTGCTCGATCAGTCGGGGCTCGGTCAGTCGGTGCTCGATCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 561802-563742	Sequence	GPOL_c04790 - ABC transporter ATP-binding protein/permease (Protein is coded in complementary strand; from 563742 to 561802)