Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4624814
End position: 4624858
Length: 45

DNA sequence
>NC_016906, from 4624814 to 4624858 (45 bp); Gordonia polyisoprenivorans VH2 CCCAACGGATCACACTCCACCGGATCACACCCCGCCGAATCACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 4623868-4624827	Sequence	GPOL_c40570 - hypothetical protein (Protein is coded in complementary strand; from 4624827 to 4623868)