Sequence retrieval

Genome: Gordonia polyisoprenivorans VH2
Start position: 4547345
End position: 4547389
Length: 45

DNA sequence
>NC_016906, from 4547345 to 4547389 (45 bp); Gordonia polyisoprenivorans VH2 ACGGGGGCACCGGCGGTTGGGGCACCGGCGGTTGGGGCACCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4546567-4548363	Sequence	GPOL_c39880 - putative serine/threonine protein kinase (Protein is coded in complementary strand; from 4548363 to 4546567)